Ol shows a 54 reduction in GFP-SMO+miR-30 compared to GFP-SMO only embryos. (I) Protein blot analysis of smoothened levels in wild type and miR-30 morpholino knockdown embryos shows an increased level of Smoothened protein. (J) Densitometric analysis of the average change in smoothened protein level in 3 samples of wild type versus miR-30 morpholino treated embryos. doi:10.1371/journal.pone.0065170.gother work has shown that Ptc-mediated inhibition can be overcome by high levels of Smoothened [64]. Here, we show that such an increase in Smoothened protein levels is induced by morpholino-mediated knock-down of the miR-30 family in zebrafish embryos. This increase in Smoothened protein levels leads to an up-regulation of Hh signalling in the developing HIV-RT inhibitor 1 web somites that ultimately results in a very specific muscle fibre patterning defect, namely the development of slow instead of fast muscle fibres. A similar defect had previously been described in embryos in which the Hh pathway had been over-activated by forced expression of Hh ligands or dominant negative PKA in all tissues of the early embryo (35). The phenotype generated from target protection of the miR-30 site within the smoothened mRNA transcript, demonstrating the specific effect of this interaction,produces a defect in early muscle specification resulting in flattened somites and loss of the characteristic chevron structure. The experiments conducted in this study demonstrate a critical interaction between the miR-30 family and smoothened mRNA in the developing zebrafish embryo. Increased Smoothened levels in the somites results in an abnormal patterning of the muscle fibres. In the miR-30 morphants, Smoothened levels are MedChemExpress Tetracosactrin elevated and as such the somitic cells located more laterally are capable of pathway activation and hence develop into slow rather than fast muscle fibres. In the wild-type embryo only adaxial cells receive a Hh signal strong enough to relieve Ptc-mediated Smoothened inhibition. Our data suggest that in the wild-type embryo miR-30 regulation of smoothened mRNA maintains the correct cellular levelmiR-30 Targets smoothened in Zebrafish Muscletarget protector sequence was GTGTATGTAAACACCATAAACTGAC and was injected at 9 ng/embryo.ImmunohistochemistryEmbryos were immersed in 30 sucrose for 60 minutes and frozen in OCT (R A Lamb) using liquid nitrogen cooled isopentane. 20 mm-thick sections were cut on a cryostat (Microm HM505E) and collected on APES COATED glass slides. Frozen sections were fixed in 1 PFA and blocked in 5 BSA:PBS with triton-X to a final concentration of 0.3 . Antibodies were mouse monoclonal against myosin heavy chain (S58) 1:50 dilution, and myosin (MF20) 1:100 dilution. Monoclonal antibodies, S58 developed by F.E. Stockdale and MF20 developed by D.A Fischman, were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biology, Iowa City, IA 52242. Secondary antibodies against mouse IgG were Alexafluor labeled 488 (green fluorescent) and 555 (red fluorescent) and used at 1:300 dilution (Invitrogen). Sections were mounted with Vectashield Mounting Medium with DAPI (Vector).Figure 4. Analysis of Ptc1 reveals the position of miR-30 regulation in the Hh pathway. Ptc1 in situ hybridization shows the level of Hh pathway activity in different embryo treatment types. (A) Wild type embryo, (B) miR-30 overexpression embryo, (C) miR-30 morpholino injected embryo,.Ol shows a 54 reduction in GFP-SMO+miR-30 compared to GFP-SMO only embryos. (I) Protein blot analysis of smoothened levels in wild type and miR-30 morpholino knockdown embryos shows an increased level of Smoothened protein. (J) Densitometric analysis of the average change in smoothened protein level in 3 samples of wild type versus miR-30 morpholino treated embryos. doi:10.1371/journal.pone.0065170.gother work has shown that Ptc-mediated inhibition can be overcome by high levels of Smoothened [64]. Here, we show that such an increase in Smoothened protein levels is induced by morpholino-mediated knock-down of the miR-30 family in zebrafish embryos. This increase in Smoothened protein levels leads to an up-regulation of Hh signalling in the developing somites that ultimately results in a very specific muscle fibre patterning defect, namely the development of slow instead of fast muscle fibres. A similar defect had previously been described in embryos in which the Hh pathway had been over-activated by forced expression of Hh ligands or dominant negative PKA in all tissues of the early embryo (35). The phenotype generated from target protection of the miR-30 site within the smoothened mRNA transcript, demonstrating the specific effect of this interaction,produces a defect in early muscle specification resulting in flattened somites and loss of the characteristic chevron structure. The experiments conducted in this study demonstrate a critical interaction between the miR-30 family and smoothened mRNA in the developing zebrafish embryo. Increased Smoothened levels in the somites results in an abnormal patterning of the muscle fibres. In the miR-30 morphants, Smoothened levels are elevated and as such the somitic cells located more laterally are capable of pathway activation and hence develop into slow rather than fast muscle fibres. In the wild-type embryo only adaxial cells receive a Hh signal strong enough to relieve Ptc-mediated Smoothened inhibition. Our data suggest that in the wild-type embryo miR-30 regulation of smoothened mRNA maintains the correct cellular levelmiR-30 Targets smoothened in Zebrafish Muscletarget protector sequence was GTGTATGTAAACACCATAAACTGAC and was injected at 9 ng/embryo.ImmunohistochemistryEmbryos were immersed in 30 sucrose for 60 minutes and frozen in OCT (R A Lamb) using liquid nitrogen cooled isopentane. 20 mm-thick sections were cut on a cryostat (Microm HM505E) and collected on APES COATED glass slides. Frozen sections were fixed in 1 PFA and blocked in 5 BSA:PBS with triton-X to a final concentration of 0.3 . Antibodies were mouse monoclonal against myosin heavy chain (S58) 1:50 dilution, and myosin (MF20) 1:100 dilution. Monoclonal antibodies, S58 developed by F.E. Stockdale and MF20 developed by D.A Fischman, were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biology, Iowa City, IA 52242. Secondary antibodies against mouse IgG were Alexafluor labeled 488 (green fluorescent) and 555 (red fluorescent) and used at 1:300 dilution (Invitrogen). Sections were mounted with Vectashield Mounting Medium with DAPI (Vector).Figure 4. Analysis of Ptc1 reveals the position of miR-30 regulation in the Hh pathway. Ptc1 in situ hybridization shows the level of Hh pathway activity in different embryo treatment types. (A) Wild type embryo, (B) miR-30 overexpression embryo, (C) miR-30 morpholino injected embryo,.
