Pletion of Caveolin-1 in RPMVECCaveolin-1 RNAi lentiviruses were packaged with the use of a four-plasmid system as described previously [21]. Two lentivirus particles, which express caveolin-1-shRNA or a negative control shRNA, were used to infect RPMVEC (Targeting caveolin-1 shRAN sequence:GACGTGGTCAAGATTGACTTT;negative control sequence:GCTTTGTGATTCAATCTGTAA) [22]. 16106 RPMVEC were seeded in a 6 cm plate. The next day, the medium was replaced with fresh DMEM containing 15 fetal calf serum, lentivirus and the medium with 8 mg/ml polybrene. The supernatant with the lentivirus particles was replaced the following morning with media containing 15 fetal calf serum.Measurement of Transendothelial Resistance (TER)An epithelial volt-ohm meter and STX-2 electrodes (EVOM; World Precision Instruments, Sarasota, FL, USA) was 1317923 was purchased from Wuhan Boster Benzocaine web Biological Engineering Co, Ltd (Wuhan, China). Transwell clear polyester membrane cell culture chambers (24-well type, 6.5 mm diameter, 0.4 mm pore size) were purchased from Costar (Cambridge, MA). High glucose Dulbecco’s modified Eagle’s medium (DMEM) were purchased from Invitrogen (Carlsbad, CA). Fetal calf serum, penicillin, streptomycin, and trypsin were purchased from HyClone Laboratory (Salt Lake City, UT).Fluorescent Staining56104 RPMVECs were seeded on 2 cm2 coverslips and grown for 12 hours. The coverslips were washed with phosphat.Pletion of Caveolin-1 in RPMVECCaveolin-1 RNAi lentiviruses were packaged with the use of a four-plasmid system as described previously [21]. Two lentivirus particles, which express caveolin-1-shRNA or a negative control shRNA, were used to infect RPMVEC (Targeting caveolin-1 shRAN sequence:GACGTGGTCAAGATTGACTTT;negative control sequence:GCTTTGTGATTCAATCTGTAA) [22]. 16106 RPMVEC were seeded in a 6 cm plate. The next day, the medium was replaced with fresh DMEM containing 15 fetal calf serum, lentivirus and the medium with 8 mg/ml polybrene. The supernatant with the lentivirus particles was replaced the following morning with media containing 15 fetal calf serum.Measurement of Transendothelial Resistance (TER)An epithelial volt-ohm meter and STX-2 electrodes (EVOM; World Precision Instruments, Sarasota, FL, USA) was 23115181 used to measure transendothelial resistance (TER, cm2) across the endothelial monolayer according to the manufacture’s protocol as described previously [19,20]. RPMVEC (26105 cells/cm2) were seeded on gelatin-coated transwell polyester membranes and grown to confluence for 48 h. Cells were then allowed to stabilize for 24 h, incubated with fresh culture medium in the presence or absence of TNF-a for different time points. The changes of TER across RPMVEC monolayer were recorded.Measurement of Fluorescein Isothiocyanate (FITC)-BSA Flux Across Monolayers of Cultured Endothelial CellsEndothelial cells were seeded on top of the transwell chamber in 24-well plates (0.4 mm pore size) and grown to confluence. The monolayers were serum-starved for 1 h then incubated with fresh culture medium in the presence or absence of TNF-a for the different time points, as described below. At the end of the stimulation, FITC-BSA (10 mg/ml, Sigma) and an equimolar amount of unlabeled BSA were mixed with phenol red-free DMEM and added to the top chamber and the bottom chamber, respectively, for 1 h at 37uC. Paracellular flux was assessed by obtaining aliquots from both chambers to measure the real-time changes of permeability across the endothelial cell monolayers. The concentration of FITC-BSA was quantified with a fluorescence spectrofluorophotometer as described previously [23]. The BSA flux was calculated as a ratio between the fluorescence intensity in the lower compartment and the upper compartment. The data were expressed as a percentage of the control.Materials and Methods ReagentsTNF-a was purchased from Peprotech Inc. (Rocky Hill, NJ). Caveolin-1 antibody was purchased from Abcam Inc. (Cambridge, MA). Polyclonal anti-cortactin antibody, rhodamine-conjugated phalloidin, FITC-labeled BSA and unlabeled BSA were purchased from Sigma-Aldrich (St. Louis, MO). NSC-23766 was obtained from Calbiochem/Merck (Darmstadt, Germany). 8-pCPT-20 -OMethyl-cAMP (O-Me-cAMP) was from Biolog Life Science Institute (Bremen, Germany). Horseradish peroxidase (HRP)labeled antibody to rabbit IgG 1317923 was purchased from Wuhan Boster Biological Engineering Co, Ltd (Wuhan, China). Transwell clear polyester membrane cell culture chambers (24-well type, 6.5 mm diameter, 0.4 mm pore size) were purchased from Costar (Cambridge, MA). High glucose Dulbecco’s modified Eagle’s medium (DMEM) were purchased from Invitrogen (Carlsbad, CA). Fetal calf serum, penicillin, streptomycin, and trypsin were purchased from HyClone Laboratory (Salt Lake City, UT).Fluorescent Staining56104 RPMVECs were seeded on 2 cm2 coverslips and grown for 12 hours. The coverslips were washed with phosphat.
